rs72736013 chr1:198550149 A>G
- Sequence
atagagaactgagattgcttgact[A/G]tgaccttctttccataacctccct
- ASB in cell types
- monocyte-derived macrophages from peripheral blood GM12878 (female B-cells lymphoblastoid cell line) MDM(monocyte derived macrophages) CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.13 | 0.48 | 1.29 | n/a | No Hit | |||
| RELB_HUMAN | -0.66 | 2.21 | 1.25 | n/a | No Hit |
Items per page:
1 – 2 of 2