rs72738619 chr5:17203533 T>C
- Sequence
tttttgaacaagcctgccaccttg[T/C]ggttatttggaaaaccagactggc
- ASB in cell types
- THP-1 (acute monocytic leukemia) upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.92 | 0.30 | 1.33 | -2.15 | Concordant | |||
| RAD21_HUMAN | 1.57 | 0.24 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
