rs72741299 chr15:65829406 G>A
- Sequence
caacatgaaaataccgtcatggga[G/A]ttggtgaattcagtcaatacccag
- ASB in cell types
- HEK293 (embryonic kidney) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.58 | 0.89 | 1.05 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 0.77 | -0.53 | 1.00 |
Items per page:
1 – 2 of 2