rs72743351 chr5:33970054 G>A
- Sequence
tcctagtggtgaccagggagcaca[G/A]ggcacaaatgctagaatgaaaaag
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 0.05 | 0.45 | 1.11 | |||
| LNCaP (prostate carcinoma) | 0.84 | -0.41 | 1.17 |
Items per page:
1 – 2 of 2