rs72744331 chr9:74173111 T>C
- Sequence
cacaatatggtaatctcgagtcag[T/C]cagactttttgcatggtagctagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) macrophages form periferal blood
- ASB for transcription factors
- IKZF2_HUMAN HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.51 | -1.21 | 1.00 | n/a | n/a | |||
| HTF4_HUMAN | 2.27 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2