rs72754526 chr15:85475526 A>G
- Sequence
gagttcctctttccagaggtacca[A/G]ccatcatgtgggatcctaagtata
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.53 | -0.96 | 1.17 |
Items per page:
1 – 1 of 1