rs72756326 chr5:30401708 G>A
- Sequence
gcggcagagagacataagacaggt[G/A]aaaagaaaggtcatgttgggttgt
- ASB in cell types
- SK-N-AS (neuroblastoma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-AS (neuroblastoma) | 2.56 | -2.23 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | n/a | 0.93 | 6.00 |
Items per page:
1 – 2 of 2