rs72757225 chr9:129889657 C>T
- Sequence
ggctcctggaaaggagaggatgtt[C/T]gctttgcaatgagctggtgcagag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.64 | 0.81 | 1.04 | |||
| primary B-CLL cells | 2.08 | n/a | 2.50 |
Items per page:
1 – 2 of 2