rs72759376 chr1:227344590 C>G
- Sequence
gagaagattagttaagtggcagat[C/G]tgtctgtgtgtgtgtgtgtgtgtg
- ASB in cell types
- 22RV1 (prostate carcinoma) D283 Med (medulloblastoma) A549 (lung carcinoma)
- ASB for transcription factors
- ANDR_HUMAN OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.19 | -0.54 | 1.90 | 2.65 | Discordant | |||
| OTX2_HUMAN | 3.23 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Testis, Thyroid