rs72762658 chr9:114271947 A>G
- Sequence
acattttcttgcaagagcgagagc[A/G]ccccctgtctgtcatctgcctgac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) IPSC-derived bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.89 | 2.57 | 1.88 | 3.33 | Concordant | |||
| STAG1_HUMAN | -0.76 | 2.61 | 2.70 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
