rs727631 chr2:38153674 C>G
- Sequence
gaggaggctcatgtgcccaaaatg[C/G]agtcagtaggagataaggtcagag
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.75 | 0.17 | 2.05 | |||
| 22RV1 (prostate carcinoma) | 2.18 | -1.01 | 2.00 |
Items per page:
1 – 2 of 2