rs72764737 chr15:91142293 T>C
- Sequence
aatttaattacctcttttgctacc[T/C]tttcacttgctaactcatgctgtc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM18505 (female B-cells Lymphoblastoid Cell Lines) pancreas ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.29 | -0.21 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.37 | -0.30 | 1.00 | |||
| pancreas | -1.41 | 1.16 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.52 | -1.34 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Sigmoid, Colon_Transverse, Muscle_Skeletal, Nerve_Tibial, Pancreas