rs72767763 chr9:122099547 C>T
- Sequence
gcgagctctgcccagctaagcttg[C/T]aaacacacacatttttgcacctct
- ASB in cell types
- foreskin keratinocyte erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.51 | n/a | 2.33 | |||
| erythroid cells | 1.66 | -4.29 | 2.00 |
Items per page:
1 – 2 of 2