rs72768001 chr9:127586591 G>A
- Sequence
catccgctccctggacctgcagtg[G/A]actgttgactccagccctgctcca
- ASB in cell types
- epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.60 | n/a | 2.00 |
Items per page:
1 – 1 of 1