rs727683 chr18:53657477 G>A
- Sequence
gtggtaattcattacagcagccag[G/A]aagctattgagatgggatctggct
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 1.78 | -0.04 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, hdl cholesterol change with statins, hypertension (early onset hypertension), lp-pla2 activity, lp-pla2 mass, partial epilepsy, rheumatoid arthritis