rs72771163 chr5:81299721 T>C
- Sequence
cgccctctagtggtatgttatgtg[T/C]aagtaccttgcatctaccaaagat
- ASB in cell types
- neutrophils from periferal blood GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.54 | -4.45 | 1.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.83 | 0.87 | 1.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood