rs72773885 chr16:11371770 C>T
- Sequence
cttcatctagcacctgctatgcac[C/T]agggattcatgggggggatggtgg
- ASB in cell types
- HepG2 (hepatoblastoma) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.08 | 0.35 | 2.95 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.44 | -1.18 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Thyroid