rs72774922 chr5:81830680 T>C
- Sequence
tccttttaaacaattttaaataat[T/C]cactacaaagtgaaatctggcata
- ASB in cell types
- K562 (myelogenous leukemia) MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.27 | 0.97 | 2.00 | |||
| MDM(monocyte derived macrophages) | 2.02 | 0.71 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.46 | 1.30 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg