rs72776863 chr10:2950022 G>A
- Sequence
gccctggaagggcattgcctgacc[G/A]tgactgcagcccagccagtgaggc
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- JUND_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | -2.86 | 3.22 | 1.00 | n/a | No Hit | |||
| JUN_HUMAN | 0.63 | 2.36 | 1.00 | 0.58 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
