rs72778883 chr10:32205883 C>T
- Sequence
gccttcctgttatgttacattaaa[C/T]gagtcatagttgatggaatttgtg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- NOTC1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | 1.73 | n/a | 2.50 | n/a | n/a | |||
| TF65_HUMAN | 1.58 | -5.04 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg