rs72779566 chr10:13117952 G>T
- Sequence
cttttttggttaacaattcttcac[G/T]tttcccccaaattgcttttgtcat
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.21 | -0.02 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.02 | 1.15 | 1.24 |
Items per page:
1 – 2 of 2