rs72782791 chr5:90866345 A>G
- Sequence
gtgtgtgtgtgtgtgtgtgtgtgt[A/G]ttttcttgattggaggaatataga
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM10847 (female B-cells Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.61 | -2.15 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 2.50 | 1.73 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.68 | -0.01 | 2.00 |
Items per page:
1 – 3 of 3