rs72786822 chr5:125612530 A>C
- Sequence
atgctaggcatgttgcccgcatcc[A/C]ttcgataaatgttcttttggctcc
- ASB in cell types
- MKL-1 (Merkel cell carcinoma)
- ASB for transcription factors
- MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 2.00 | -1.14 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1