rs72789952 chr5:112551715 C>T
- Sequence
gaaccatcaaatctcagccttctt[C/T]ttcaccagttttattttaatattg
- ASB in cell types
- VCaP (prostate carcinoma) hepatocytes tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.43 | n/a | 2.00 | |||
| hepatocytes | 1.48 | -1.18 | 1.00 | |||
| tibial nerve | 1.80 | -1.57 | 1.00 |
Items per page:
1 – 3 of 3