rs72790367 chr16:67857755 C>G
- Sequence
cctgctgtttagccacagctgtct[C/G]tcactaggaccttgggaatgagag
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 3.20 | n/a | 2.00 | -2.23 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Frontal_Cortex_BA9, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood