rs72791620 chr16:57519973 G>A
- Sequence
ccattgaggcctgcacaggaggcc[G/A]tagtggcagctcagcctgctctga
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.80 | 0.16 | 1.99 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.66 | 0.74 | 1.11 | |||
| K562 (myelogenous leukemia) | 0.31 | 0.78 | 2.25 | |||
| epidermal keratinocytes | 2.03 | -5.07 | 3.00 |
Items per page:
1 – 4 of 4