rs72792145 chr16:82996118 C>T
- Sequence
gcagaaggaagtaaaaccttcggg[C/T]agatgaaataattcttccatttta
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.24 | -0.77 | 3.00 |
Items per page:
1 – 1 of 1