rs72793240 chr16:72467366 T>C
- Sequence
taaagagtgccctcttgtgttgca[T/C]gcacatgaaataaccttttttttt
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) CD34+ hematopoietic stem cells
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.90 | 0.28 | 1.21 | n/a | No Hit | |||
| STAG1_HUMAN | 0.90 | -0.88 | 1.11 | n/a | n/a |
Items per page:
1 – 2 of 2