rs72793439 chr5:152457051 T>C
- Sequence
tccatggatgtccttttgctgttc[T/C]gggaaccaatccagaataccacat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CFPAC-1(pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.20 | 1.13 | 1.06 | |||
| CFPAC-1(pancreatic ductal adenocarcinoma) | -1.98 | 1.85 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Nerve_Tibial, Stomach, Thyroid