rs72795440 chr2:55015320 C>T
- Sequence
aaaaatacgtggggcaaaataatc[C/T]ctaatcggaatccaaaatcaattt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.17 | -1.27 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.81 | -0.80 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Whole_Blood