rs72795760 chr16:71311878 G>C
- Sequence
tccgagaccagcagaggctgcaag[G/C]gggtgagaggctggtggtctttga
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY7 (diffuse large B-cell lymphoma) | -0.68 | 1.44 | 1.25 |
Items per page:
1 – 1 of 1