rs727981 chr6:134352992 A>C
- Sequence
aaacacattgaagtctgatttaca[A/C]ccttgtggtcttttggagctgtaa
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SSXT_HUMAN RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSXT_HUMAN | 2.54 | -2.58 | 1.00 | n/a | n/a | |||
| RUNX2_HUMAN | 2.25 | -1.83 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, biploar disorder (bipolar schizoaffective disorder), irritible bowel syndrome, ldl cholesterol