rs727999 chr17:29219612 A>G
- Sequence
gtcagaaattagaggctaggcgct[A/G]cagccagcagggtcccgtcaaccg
- ASB in cell types
- K562 (myelogenous leukemia) neutrophils from periferal blood neural cell GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN NCOR1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.60 | 1.05 | 1.37 | n/a | No Hit | |||
| NCOR1_HUMAN | -1.11 | 1.94 | 2.00 | n/a | n/a | |||
| STAT1_HUMAN | -0.60 | 1.95 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, diastolic blood pressure (dbp), fasting blood glucose, homa-b, parkinsons disease, suicide attempts in major depressive disorder, systolic blood pressure (sbp), waist hip ratio
GTEx eQTL Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Nerve_Tibial, Testis