rs72802804 chr5:143418591 G>T
- Sequence
tggagatagaggtaaataaggtat[G/T]gcccctgccctcagggctttccca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.43 | 1.00 | 1.10 |
Items per page:
1 – 1 of 1