rs72805576 chr16:89615615 G>A
- Sequence
ccaggtcttcagagcccacaggca[G/A]agcccaccctgagggaggagcagc
- ASB in cell types
- LNCaP (prostate carcinoma) GM18951 (B-cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -1.07 | 1.80 | 1.25 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.79 | -3.10 | 1.33 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -2.61 | 1.41 | 1.33 |
Items per page:
1 – 3 of 3