rs72808158 chr10:72355704 T>C
- Sequence
taacagatcaggaaggcgaataca[T/C]tctagggagcgtaaagattctact
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN316_HUMAN ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | 2.41 | -0.77 | 1.00 | n/a | No Hit | |||
| ILF3_HUMAN | -1.60 | 1.85 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid