rs72817384 chr17:2828634 C>T
- Sequence
gtggcactgttggcccaggactgc[C/T]cgggcatggctgggagagcaggtg
- ASB in cell types
- epidermal keratinocytes foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.66 | -1.87 | 2.00 | |||
| foreskin keratinocyte | 0.51 | n/a | 2.67 |
Items per page:
1 – 2 of 2