rs72817866 chr6:8006291 C>T
- Sequence
acagcattcctaaccatcatggaa[C/T]tcataggcttttcctacattttgg
- ASB in cell types
- foreskin keratinocyte GM12892 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma) neural cell
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.56 | 0.90 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood