rs72818932 chr6:7276262 A>T
- Sequence
tatgaaaccaaaaaaaccacagac[A/T]cgagtaactatttattctccttat
- ASB in cell types
- stomach MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| stomach | 2.21 | -1.68 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 0.97 | 1.83 | 1.00 |
Items per page:
1 – 2 of 2