rs72819795 chr2:105522914 A>G
- Sequence
ccggttgcagaaacctgaagctac[A/G]aggcagagatgggtttcactgcaa
- ASB in cell types
- breast tumor MCF7L-P(immortalized breast epithelial cell line) MDA-MB-134 (invasive lobular breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 1.74 | 0.34 | 2.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.30 | 1.52 | 1.00 | |||
| MDA-MB-134 (invasive lobular breast carcinoma) | -0.21 | 1.32 | 3.00 |
Items per page:
1 – 3 of 3