rs728589 chr6:142850876 G>A
- Sequence
gtggttctcaccctgaacactgtc[G/A]caggacaagaaaacagtcactttg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -2.26 | 1.85 | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, chronic kidney disease, college completion, fasting blood glucose, hdl cholesterol, maternal transmission distortion, years of education