rs729057 chr5:151448443 T>G
- Sequence
attttccaccgctggggttggatt[T/G]gctctgggtgtggttccctgtttg
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.48 | -1.70 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, panic disorder, resistance to kuru in aged women despite likely exposure, serum creatinine, stabilized warfarin dose, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Cortex, Brain_Hippocampus, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid