rs7292561 chr22:16917618 T>C
- Sequence
gccacaggggggcagtcgcacaca[T/C]gactttattgggtgacgttttgtc
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.52 | n/a | 2.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.30 | 1.02 | 1.15 | |||
| THP-1 (acute monocytic leukemia) | 0.95 | 0.59 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, microalbuminuria, refractive error, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (substance abuse/dependence), total cholesterol