rs7295448 chr12:124936407 A>G
- Sequence
gtggtttttctagagtcttttatc[A/G]ggcctgcaagcacgggaaccctct
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.04 | -0.06 | 2.02 | |||
| HepG2 (hepatoblastoma) | 1.27 | -0.24 | 1.06 |
Items per page:
1 – 2 of 2