rs7295830 chr12:100741299 G>C
- Sequence
cacgacactcaacaatttatagat[G/C]ctgccacctagaggtaagatgctg
- ASB in cell types
- T47D (invasive ductal carcinoma) PC9 (lung adenocarcinoma) GM19239 (male B-cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.69 | 0.20 | 1.35 | -1.77 | Weak Concordant | |||
| STAG1_HUMAN | 1.65 | -0.89 | 1.33 | n/a | n/a | |||
| RAD21_HUMAN | 1.25 | 0.35 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, college completion, ldl cholesterol, mitral annular calcium, waist hip ratio, years of education