rs729614 chr9:135667037 A>G
- Sequence
agatgtgaaaacgactgcatttgt[A/G]tgatgctctcgaaatcacaaaacc
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | 1.64 | -1.31 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, aortic valve calcium, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hypertension (early onset hypertension), maternal transmission distortion, transmission distortion