rs729737 chr17:57783639 G>A
- Sequence
cagttctctagggcgtcctggtta[G/A]gtcaacgggggctggttgggaacc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.40 | 1.10 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, hdl cholesterol, hypertension (early onset hypertension), infant head circumference, irritible bowel syndrome, rheumatoid arthritis