rs7297472 chr12:83826294 A>C
- Sequence
atggctacaggtgcagtcatgatg[A/C]gctcctgtagggggagccccaatt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.66 | 1.52 | 1.11 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 0.20 | 1.44 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.58 | 1.02 | 1.00 |
Items per page:
1 – 3 of 3