rs7298333 chr12:2004182 A>C
- Sequence
agatccacccacttccagggcgtc[A/C]acgtctcctccccctcaccgggtc
- ASB in cell types
- primary B-CLL cells GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.34 | n/a | 2.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -2.22 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2