rs7299608 chr12:7933466 G>C
- Sequence
tatgaggtgaaagagtgggaggaa[G/C]aacagcaccgcccagcgttccggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) RH4 (alveolar rhabdomyosarcoma) hepatocytes HMEC (human mammary epithelial cells)
- ASB for transcription factors
- RAD21_HUMAN STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.28 | 1.53 | 1.58 | n/a | n/a | |||
| STAG2_HUMAN | -1.54 | 2.01 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus